zzhaileyzz zzhaileyzz

Today at 3:32 PM
Geography

Answered

Which of the following situations is the best example of voluntary migration?

Answer :

madhurima madhurima

Today at 3:37 PM

family chooses to move

Answer Link

Today at 3:37 PM

Answer:

D

Explanation:

I did it

Answer Link

Other Questions

What is something you could say to someone that is trying to pressure you into drinking alcohol?

What is something you could say to someone that is trying to pressure you into drinking alcohol?

can someone help me plz

The Venn diagram above shows the results of a survey of 200 readers on the type of magazine they read. If a respondent is chosen at random, what is the probabil

help me with this please

please answer my question

Neural networks and vector quantization speaker identification

Observe a lista de números a seguir: somando todos os positi

why it is essential to have a standard system of units

Few Lines on Ocean in Hindi

If the pressure of a gas is really due to the random collisions of molecules with the walls of the container, why do pressure gauges – even very sensitive ones

A person is riding a bicycle, and its wheels have an angular velocity of 19.4 rad/s. Then, the brakes are applied and the bike is brought to a uniform stop. Dur

Three months of rent were prepaid on May 1 for $7,200, but two months have now expired, leaving only one month prepaid at June 30. What is the amount of rent ex

To make a 0.500 M solution, one could take 0.500 moles of solute and add Group of answer choices enough solvent to make 1.00 kg of solution. enough solvent to m

Chelsea’s manager sent her an email asking to meet, for an unspecified reason, the following Friday. Upon reading this email, Chelsea remembered a situation six

According to George Vaillant's longitudinal studies, in middle age was more strongly related than intimacy to whether individuals would have an enduring and hap

A cement block accidentally falls from rest from the ledge of a 53.4-m-high building. When the block is 19.4 m above the ground, a man, 2.00 m tall, looks up an

The struggle for equal rights is still ongoing. Minorities face many struggles in acquiring social, political, and economic equality. While de jure discriminati

Suppose that there is no third-party payer in the medical care market in Uganda in 1955. Suppose that in 1960, health insurance companies begin operations in Ug

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid