firdous2004 firdous2004

Today at 5:10 PM
Mathematics

Answered

Please help me! I will mark you brainliest!

Please help me! I will mark you brainliest! class=

Answer :

Аноним Аноним

Today at 5:15 PM

Answer:

Second option is the correct choice.

Step-by-step explanation:

[tex]k=6\quad and \quad E(X)=\frac{-7\:\:}{15}[/tex]

Regards: Umer

Answer Link

Other Questions

Select the correct term to complete each sentence. If you the wavelength, the electromagnetic radiation energy will double. The energy of the electromagnetic ra

Select the correct term to complete each sentence. If you the wavelength, the electromagnetic radiation energy will double. The energy of the electromagnetic ra

A copper block rests 17.4 cm from the center of a steel turntable. The coefficient of static friction between block and surface is 0.465. The turntable starts f

bramble reported total asset s of and net income of for the current year. what is the corrected amount for toal assets and net income for the yeqr

A segment of a roadway has a free flow speed of 45 mph and a jam density of 25 ft per vehicle. Determine the maximum flow and at a flow rate of 1950 vph

pls answer this question

True or False: Creating a Risk Assessment Worksheet (RAW) is

pls answer fast .......

we can have a triangle whose sides have lengths 4.8 cm , 6.2 cm and 10.5 CM

I want clear explanation To find the median of 2/3,4/5,1/2,3/4,6/5

g Catalyzes a substrate level phosphorylation - breaks down sucrose to glucose and fructose - is a type of isomerase - removes one glucose residue from glycogen

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What

By weight atmospheric air is approximately 23.15% oxygen and 76.85% nitrogen. What is the partial pressure of oxygen in the air at standard temperature and pres

) If the standard deviation of a random variable X is 15 and a random sample of size n=15 is obtained, what is the standard deviation of the sampling distribut

Loyalty programs that are most likely to provide a sustainable advantage and to survive in the grocery industry are those that

One test currently done to positively identify individuals infected with SARS-CoV-2 is Group of answer choices to identify the viruses under an electron microsc

The marginal tax rate for a lump-sum tax a. is always positive. b. is zero. c. can take on any value but must be greater than the average tax rate. d. is always

What is the distance, in meters, between adjacent fringes produced by a diffraction grating having 125 lines per centimeter

Harry, Hermione, and Ron formed an S corporation called Bumblebore. Harry and Hermione both contributed cash of $29,500 to get things started. Ron was a bit sho

Equivalent Units of Materials Cost The Filling Department of Eve Cosmetics Company had 4,200 ounces in beginning work in process inventory (40% complete). Durin