Anonyme
Anonyme
Today at 4:14 PM
Mathematics
Answered
Help!! Asap due soon
Answer :
ameliadonaldson6
ameliadonaldson6
Today at 4:19 PM
Answer: 3. (3,6,5)
Steps
Answer Link
laura19770
laura19770
Today at 4:19 PM
did u get ur answer ?
Answer Link
VIEW ALL ANSWERS ( 67+ )
Other Questions
if the numerator of a fraction is multiplied by 4 and the denominator is reduced by 2, the result is 2. If the numerator of the fraction is increased by 15 and
parson says “We wish to get at it by degrees.” Does this statement make him seem more radical or more moderate?
parson says “We wish to get at it by degrees.” Does this statement make him seem more radical or more moderate?
Who did mitchell palmer tend to go after with his infamous raids? a. native-born people that were accused of robbing banks throughout the united states b. forei
can anyone help me with this1 - 18.35 × 10 -² GN 2 - 0.0052 Tm 3 - 1234003 PN
explain about secondary metabolites in plants
How do fungi and algae benefit each other?what is the relationship called?
What is the main seasons of India?Which option is correct.i. The main seasons of India are summer, rainy and winter.ii. The main seasons of India are summer, w
New syllabus mathematics D1h
find six rational numbers between 3 and 4
Calculate the mean, median, and mode of the following set of data. round to the nearest tenth. 11, 9, 7, 6, 8, 2, 15, 1, 12, 15, 14mean: 11 + 9 + 7 + 6 + 8 + 2
How did the "old way" of gaining knowledge change with the Scientific Revolution? Address specific people such as Copernicus, Galileo, Bacon, Descartes, etc. in
Factorise this expression 5x2+15x+10
Batman's age is 12 less than triple Robin's age. When you add Batman's age to Robin's age, you get 68. How old is Batman and how old is ...
x-intercept = and y-intercept = 4
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
3 different types of substance that may preserve an entire organism.
Aisha borrows #18500 at 6 compound Interest,She pays back #45,000 at the end of each year.How much does she still owes after she has made her second repayment.
A urine specimen may be taken from a clean bedpan or urinal for what type of urine testing?
In this net, the two triangles. All quadrilaterals are rectangles. What is its surface area in square units?
