mooniBa0riading mooniBa0riading

Today at 9:24 PM
Mathematics

Answered

Use the SAS Congruence Axiom to prove the ASA criterion ...?

Answer :

alsteva alsteva

Today at 9:29 PM

Given the SAS, we can use the CPCPT (congruent parts of congruent triangles are congruent) and get the ASA.

Answer Link

Other Questions

Describe the role of the church of england in early elizabethan society.

Find the value of 3127°B5xАC с3x + 6D127°c

Find the value of 3127°B5xАC с3x + 6D127°c

4^3/(-12+ 2^2) (2x2)^2 + (-5 x 2 x 3 ) + 2[tex] \frac{4^3/(-12 +2^2)}{(2x3)^2 +(-5 x2 x 3)+2} [/tex]i need help!!

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Who is known as father of botany ?

use of plastic in 100 -120 words

Write a well labelled diagram of neurin cell

what is the meaning of nitrogen

Please give me the right answer

simplify 2a x a x 3a + b x 4b

CAN SOMEONE HELP WITH THIS QUESTION?✨

given a function's domain values: -9, -6, -3, 0, 1.5, and 3, what is the range of the function's inverse?

(4, - 1); 3x - 5y = 2How do I get the real answer of this?

Social Security numbers are of the formXYZ - MN - ABCD.The first three digits XYZ are referred toas the area number. The number isassociated with where you regi

A 21 oz bottle of dish soap sells for $8.47. A 25 oz bottle of dish soap sells for $9.78.(round all answers to four decimal places)The unit price of the 21 oz b

Astronauts in training are subjected to extreme acceleration force by the centripetal forces in a giant centrifuge. a, calculate the approximate centripetal for

Mrs. publinsky and her husband, xander, are planning their dream house. the lot for the house sits high on a hill with a beautiful view of the white mountains.

Read the sentences and look at the underlined words. (8) to understand the popularity of electric vehicles circa 1900, it is also important to understand the de

3. The results of the primary election are shown. Smith 15% Goron 35% Other 10% Fishman 40% (a) Order the popularity of the choices from greatest to least. (b)