TanjanviKMC3arenee8 TanjanviKMC3arenee8

Today at 9:24 PM
History

Answered

The _ spacecraft named ____ was the first object to orbit the Earth.
A. U.S.; Apollo
B. Soviet; Sputnik
C. U.S.; Vostok ...?

Answer :

thatonejuan thatonejuan

Today at 9:29 PM

The answer is B. Soviet;Sputnik.

Answer Link

MattMurdock MattMurdock

Today at 9:29 PM

The Soviet spacecraft named Sputnik was the first object to orbit the Earth. It was launched 4 October 1957.

Answer Link

Other Questions

Hi, I need help with this problem please. No explanations/steps required. Just need the final answer

PLEASE HELP SCIENCEee

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

16. An empty jar has a volume of8x2 + 2x - 4 cubic inches. Josh pours4x2 – 3x +2 cubic inches of waterinto the jar. How many more cubicinches of water could the

Find the value of 3127°B5xАC с3x + 6D127°c

give 100 example of balanced equation

What were the experience of griffin's adventure in the emporium?

one word substitution = Who sells flag?

What is the main function of the vacuoles in an animal cell?

The development of a mood disorder can be influenced by:1. G

Need help hurryy!!!!!!!!!!!

What power is emitted by a circuit with a 9.00 volt battery and a 50.0 Ohm resistor? A)450 W B)0.00222 W C)1.62 W D)5.55 W E)0.180 W

in the collection of data, list at least 3 important constants

Following the French defeat, Native Americans were happy to trade with the British

A glass jar contains 3 red, 13 green, 4 blue, and 8 yellow marbles. If a single marble is chosen at random from the jar, what is the probability of choosing a(a

You have the option of borrowing money from one source that charges simple interest or from another source that charges the same APR but compounds the interest

Two blocks are connected by a string with negligible mass that passes over a pulley with nonzero rotational inertia I, as shown above. The axle of the pulley ha

Makly Brown nodod startup money for her lashcape service. She borrowed $12,000 to 30 months and paid $1,770 intelest on the loan that interest rate did she pay

A cube is dilated by a factor of 3.5.The volume of the resulting cube is times the volume of the original cube.

2x+3y=5 at (-2,3) find the equation of the tangent line