xXChillinThugXx xXChillinThugXx

Today at 12:13 PM
Health

Answered

______ are the body's primary and immediate source of energy.

Answer :

Today at 12:18 PM

carbohydrates are the body's quickest way to revive energy they are also used the most

Answer Link

adamtownsend adamtownsend

Today at 12:18 PM

Answer:

carbohydrate

Explanation:

Answer Link

Other Questions

In the electrolysis of a CuSO₄ solution, how many grams of Cu are plated out on the cathode in the time that it takes to liberate 5.6 litre of O₂, measured at S

In the electrolysis of a CuSO₄ solution, how many grams of Cu are plated out on the cathode in the time that it takes to liberate 5.6 litre of O₂, measured at S

An element X combines with oxygen to form compounds P and Q. If the ratio of the valency of element X in P to element X in Q is 3:5 respectively, what could be

A wire suspended vertically from one of its ends is stretched by attaching a weight of 200 N to the lower end. The weight stretches the wire by 1 mm. Then the e

There are 4 boys and 3 girls.they sit in arrow randomly.what is the probability that all girls are together?a. 1/14b. 2/14c. 5/14d. 3/14

Change: the lion carried its baby with his hands to active sentences

WHAT IS the most comfortable thing on this earth?

what do you mean by human trafficking? Define polity.

6. Train a fine tree model { minimum leaf size of 4 jto precict AveSpeed using predictor variables Distance. TimeOfDay,and DayOfWeekWhat is the training RMSE?Pr

what was satta in history class 8

Suppose {xₙ} is a decreasing sequence of positive numbers. Prove that the sum ∑xₙ converges if and only if ∑2ⁿx₂ₙ converges.

Identify the terms that can be applied to viruses. (Multiple select question) a) Parasites b) Producers c) Intracellular d) Obligate

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

The interval between human chorionic gonadotropin (HCG) priming and oocyte retrieval affects euploidy rate in PGS cycles.a. trueb. false

Ethanol is added to a tertiary alkyl bromide and is heated. The species given are the intermediates from the first step.

Which of the following is a common programming technique in functional programming for iterating over a data structure? a) For loop b) While loop c) Recursion d

A 500 HP, 3-phase motor is operated at 2400 volts with an 87% power factor. How much line current is drawn by the motor?

Determine (a) the ph of the original buffer described in sample exercise 17.5 after the addi- tion of 0.020 mol hcl and

The only time reengineering enters into work with a legacy system is when its components will be implemented as objects.a. trueb. false

If someone views an ad for a product endorsed by a celebrity they do not like, after viewing it many times, they will: