ashalise2466 ashalise2466

Today at 6:53 AM
Social Studies

Answered

What region is in pink? Southeast, Plains, Northern Woodlands, Southwest, or Pacific Northwest?

Answer :

Other Questions

Question 38 of 60 Why was the success of the American Revolution an important motivating factor behind the French Revolution? A. It showed French citizens that

13. Egyptian leaders who were considered gods in human form. They controlled the army, and all laws. A. Papyrus B. Pharaoh C. Hieroglyphics D. Dynasty

What is the area of the trapezoid?

Please help!!!!!!!!!!!!!!

What is the area of the trapezoid?

धर्मस्य" का विभक्ति,वचन बताइए। तृतीया, द्विवचनषष्ठी,एकवचनप्रथमा,बहुवचन

bonjour comment allez vous tous esperer que je vais bien et is je reste bien alors restez à la Maison translate in English please

what is the inportance of control panel

Convert 10°C into fahrenheit temperature.step by step..

For each of the following issues explain the problem for OLS and give a solution. a) E(u i 2 )=σ 2 Z b) The true model is given by Y 1 =B 0 +B 1 X 1 +

simplify and leave your answer with positive index2^n-4×16^1+n/8^-n×4^-4n

Spencer is a plumber, and his coworker Nolan is an electrician. Spencer charges customers a fee of $46 just to come to their houses and then $3 per minute that

The same quantity of electricity is passed through 2voltameters connected in series, one copper voltmeter with copper electrode in a copper(ii) tetraoxosulphate

Read the following sentence. No longer working long hours, he turned his (ATTENTION) to what he described as “Philosophical Studies and Amusements.” The multipl

Guys can u help me asap ?? i need explaination aloong the answer

writings something and putting it in a bottle in the sea mean what

From top to bottom, what is the correct order of the layers of cells in a leaf? 1.the epidermis, guard cells, palisade mesophyll, spongy mesophyll, and epidermi

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

If the perimeter of the quadrilateral is 6.1 mi. find x the missing measurement. Round your answer to the nearest tenth.

3(4x + 2) +2(x-1) please help me with this equation