makenna2 makenna2

Today at 6:25 PM
Mathematics

Answered

the value of 6 in 26.495 is .10 the value of the 6 in 17.64?

Answer :

KOHomerwork KOHomerwork

Today at 6:29 PM

Actually in the first number the value is in the ones or 1 and the value of the second is in the tenths or 0.1

Answer Link

gracetaylor gracetaylor

Today at 6:29 PM

The value is tenths. That can be written as .1

Answer Link

Other Questions

A 1-pound bag of Skittles contained 100 Red, 83 Green, 93 Orange, 80 Yellow, and 79 Purple colored Skittles. To create a pie chart of this data the angle for th

When a proposition in a persuasive speech focuses on having the listener judge the worth or importance of something, it is?

In what ways did post-revolutionary France resemble pre-revolutionary France? In what ways did it not?

After you start your vehicle, and as you begin to drive, always check your. A. windshield wipers B. accelerator linkage C.brakes D.turn signals

The points A, B, C, and D are on a number line, not necessarily in that order. If the distance between A and B is 18 and the distance between C and D is 8, what

kinetic energy of two bodies of masses are in ratio 2:3 is same.campare the ratio of their momentum

how to change username in brainly irrelevant answer will be reported

3 degree of polynomial p x is equal to X 2 + 7 x

name of the element symbol copper -silver-carbon-oxygen-sulphur-nitrogen-phosphorus-chlorine- bromine-iodine -

chemical formula of sugar

Which of the following values are zeros of x(x + 5)(x - 3)? Choose more than 1 answer A. 5 B. -5 C. 3 D. -3 E. 0

1. Parents got their chromosomes from your grandparents, and so on. But are the chromosomes that are passed along through the generations exactly the same? 2. I

A 1.2-m-tall barrel is filled with water (with a weight density of 9800 N/m^3). Find the water pressure on the bottom of the barrel. Express your answer to two

The solubility of two slightly soluble salts of M^2+ , MA and MZ2, are the same, 4 x 10^â4 mol/L. (a) which has the larger numerical value for the solubility pr

25% of the time there is free breakfast at work. You just woke up and are really hungry, so you call your coworker who is already at work, and he tells you ther

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

A 0.5-kg cart moving on a horizontal frictionless track at 0.6 m/s hits a solid bumber and bounces back with a speed of 0.4 m/s. The impulse on the cart is?

Consider the experiment of drawing two cards from the top of a standard deck of 52 cards, and the event E of the two cards having the same value. a. If we're d

"If two cards are drawn at random without replacement from a standard deck, find the probability that the second card is a face card, given that the first card

Many types of mining, such as for coal, produce a specific type of water pollution called .